human rrm2 reverse Search Results


94
Genecopoeia rrm2 promoter reporters
(A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector <t>(EV)/RRM2-overexpressing</t> PC-3 cells (PC3-EV; <t>PC3-RRM2).</t> (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.
Rrm2 Promoter Reporters, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/Promoter+reporter+clone+for+Human+RRM2/pmc06820162-183-16-19
Average 94 stars, based on 1 article reviews
rrm2 promoter reporters - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene human rrm2 reverse
MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as <t>RRM2</t> ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Human Rrm2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/RRM2+Human+qPCR+Primer+Pair/pmc08391410-89-8-14
Average 94 stars, based on 1 article reviews
human rrm2 reverse - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp rrm2 hs01072069 g1
Summary of correlative study results and relation to clinical outcomes
Gene Exp Rrm2 Hs01072069 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/Gene+Exp%2E+RRM2%2C+Hs01072069_g1/pmc03446256-171-20-15
Average 88 stars, based on 1 article reviews
gene exp rrm2 hs01072069 g1 - by Bioz Stars, 2026-09
88/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology anti rrm2 antibody
Expression levels of <t>RRM2</t> subunit in gastric cancer cell lines. (A) Expression levels of the RRM2 subunit were examined by western blotting. Each group of samples was measured separately under the same exposure conditions. Almost all cell lines expressed RRM2; however, RRM2 expression was very low in MKN45 cells. (B) Expression levels of RRM2 were examined in MKN45 cells infected with T-hTERT. MKN45 cells were infected with PBS (−) (left), T-null (middle) or T-hTERT (right). (C) Expression levels of RRM2 in MKN45 cells were semi-quantified using a densitometer and RRM2 expression was increased almost 5-fold compared with the T-null group. *P<0.005. RRM2, <t>ribonucleotide</t> <t>reductase</t> <t>M2;</t> hTERT, human telomerase reverse transcriptase; T-hTERT, oncolytic HSVs which contain the ICP6 gene under the regulation of the hTERT promoter; T-null, oncolytic HSVs which contain the ICP6 gene not regulated by the hTERT promoter.
Anti Rrm2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/%CE%B2-Actin+Antibody/pmc08100961-132-0-3
Average 96 stars, based on 1 article reviews
anti rrm2 antibody - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology human rrm2 gene specific sirna
Overexpression of <t>RRM2</t> decreased TSP-1 expression in KB-M2-D and KB-HURs cells . (A) Western blot analysis confirmed that only RRM2 was overexpressed in KB-M2-D and KB-HURs; the expression of RRM1 and p53R2 was not significantly modulated in both KB-M2-D and KB-HURs; and the expression of TSP-1 was significantly decreased in KB-M2-D and KB-HURs cells by 60%~70% (TSP1-CM: TSP-1 in concentrated condition medium, TSP1-T: TSP-1 in total protein). (B) Representative quantitative densitometric analysis of RRM2 and TSP-1 expression. Signal intensities were normalized to that of β-actin serving as loading control; data was presented as fold of KB. (C) q-RT-PCR analysis confirmed that RRM2 mRNA was dramatically overexpressed in KB-M2D and KB-HURs compared with parental KB (** p < 0.01). Values of q-RT-PCR were the mean ± SD of three independent experiments and presented as ratio to the level of parental KB cells. (D) q-RT-PCR analysis showed TSP-1 mRNA was significantly decreased in KB-M2D and KB-HURs compared with parental KB (** p < 0.01).
Human Rrm2 Gene Specific Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/R2+siRNA/pmc02662784-51-1-13
Average 93 stars, based on 1 article reviews
human rrm2 gene specific sirna - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene human rrm2b
MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and <t>RRM2B</t> ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Human Rrm2b, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/p53R2+(RRM2B)+Human+qPCR+Primer+Pair/pmc08391410-89-18-28
Average 90 stars, based on 1 article reviews
human rrm2b - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc rrm2
The <t>E2F8-RRM2</t> axis promotes DNA repair and confers drug resistance in GBC cells ( A ) Western blot analysis of E2F8 and <t>RRM2</t> protein expression in parental (NOZ, GBC-SD) and gemcitabine-resistant (NOZ-R, and GBC-SD-R) cells. GAPDH was used as a loading control ( B ) Knockdown of E2F8 using two independent shRNAs (shE2F8 #1 and #2) reduces RRM2 protein levels in NOZ-R and GBC-SD-R cells compared to non-targeting control (shNC) ( C ) Ectopic expression of E2F8 increases RRM2 protein levels in NOZ and GBC-SD cells, as shown by Western blotting ( D ) Quantification of E2F8 and RRM2 IHC staining in primary and recurrent gallbladder cancer tissues. H-scores were calculated from 10 patients per group, with recurrent cases having received gemcitabine and cisplatin treatment. Scatter dot plots represent mean ± SD (unpaired t-test; ** p < 0.01) ( E ) Representative H&E (hematoxylin and eosin) and IHC staining images of E2F8 and RRM2 in tumor tissues from 10 gallbladder cancer patients. Samples from patients 1–5 (Pt1-5) represent primary tumors, whereas those from patients 6–10 (Pt6-10) represent recurrent tumors. Scale bars: H&E, 100 μm; IHC, 50 μm ( F ) Cross-platform correlation analyses reveal a consistent positive association between E2F8 and RRM2 expression across NCI60, CCLE, and GDSC cell line datasets ( G ) E2F8 and RRM2 mRNA levels are positively correlated in the TCGA cholangiocarcinoma cohort ( H ) E2F8 knockdown sensitizes NOZ-R cells to Olaparib (1 µM, 3 days), an effect that is reversed by RRM2 overexpression. E2F8 and RRM2 protein levels were confirmed by Western blotting. Apoptotic cells were quantified by Annexin V/PI staining and flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( I ) Colony formation assays show that overexpression of RRM2 rescues the impaired proliferative capacity of E2F8-knockdown NOZ-R cells ( J ) E2F8 overexpression fails to rescue the proliferation defect induced by RRM2 knockdown in NOZ-R cells (K-L) Representative images and quantification of γ-H2AX foci in NOZ-R ( K ) and GBC-SD-R ( L ) cells. Cells with stable E2F8 knockdown (shE2F8 #1 and #2) or shNC, with or without RRM2 overexpression, were treated with Olaparib (1 µM) for 4 h prior to fixation and staining. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)
Rrm2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/RRM2+XP+Rabbit+mAb/pmc12822184-40-6-14
Average 94 stars, based on 1 article reviews
rrm2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology scramble sirna
Knockdown <t>of</t> <t>RRM2</t> increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 <t>siRNA.</t> (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.
Scramble Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/SC+siRNA/pmc02662784-51-8-13
Average 95 stars, based on 1 article reviews
scramble sirna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc anti pbrm baf180
Knockdown <t>of</t> <t>RRM2</t> increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 <t>siRNA.</t> (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.
Anti Pbrm Baf180, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/PBRM1%2FBAF180+Rabbit+mAb/pmc08727810-96-76-78
Average 93 stars, based on 1 article reviews
anti pbrm baf180 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Becton Dickinson software v10.7.2
Knockdown <t>of</t> <t>RRM2</t> increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 <t>siRNA.</t> (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.
Software V10.7.2, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/v10+7+1/pm36130505-318-221-222
Average 90 stars, based on 1 article reviews
software v10.7.2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Bio-Rad cfx96 real time pcr detection system
Knockdown <t>of</t> <t>RRM2</t> increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 <t>siRNA.</t> (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.
Cfx96 Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/CFX96+and+CFX384+Real-Time+PCR+Detection+Systems+Firmware+Update/pmc05636969-194-26-31
Average 99 stars, based on 1 article reviews
cfx96 real time pcr detection system - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc rabbit monoclonal antibodies against e2f8
Generation of gemcitabine-resistant GBC cell lines and genome-wide CRISPR screen for therapeutic targets ( A ) Dose-response curves and IC 50 values of gemcitabine in parental (NOZ and GBC-SD) and gemcitabine-resistant (NOZ-R and GBC-SD-R) cells, assessed by CellTiter-Glo viability assays after 5 days treatment. Data are presented as mean ± SD from three independent experiments ( B ) Volcano plots of differentially expressed genes (DEGs): NOZ-R versus NOZ (left) and GBC-SD-R versus GBC-SD (right). Significantly upregulated (red) and downregulated (blue) genes are defined by log 2 fold-change > 1 or < −1 and adjusted p < 0.05 ( C ) Venn diagrams illustrating the overlap of significantly upregulated (top) and downregulated (bottom) DEGs in NOZ-R and GBC-SD-R cells ( D ) Genome-wide CRISPR-Cas9 loss-of-function screen in NOZ-R cells under Olaparib versus DMSO treatment, highlighting top candidate genes with significant depletion (negative selection, left) or enrichment (positive selection, right) based on fold-change and p -value ( E ) Normalized sgRNA counts for the top 10 candidate genes identified from the CRISPR screen, with six sgRNAs per gene ( F ) Validation of selected screen hits <t>(E2F8,</t> PHF12, PTCH1 and C2orf73) by CRISPR-mediated knockout in NOZ-R and GBC-SD-R cells, followed by treatment with Olaparib (1 µM) or DMSO for 5 days. Cell viability was measured using CellTiter-Glo. Data represent mean ± SD from three independent experiments. Statistical significance was determined using two-tailed Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001; ns: not significant)
Rabbit Monoclonal Antibodies Against E2f8, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rrm2+reverse/E2F8+Rabbit+mAb/pmc12822184-40-0-14
Average 93 stars, based on 1 article reviews
rabbit monoclonal antibodies against e2f8 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


(A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector (EV)/RRM2-overexpressing PC-3 cells (PC3-EV; PC3-RRM2). (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector (EV)/RRM2-overexpressing PC-3 cells (PC3-EV; PC3-RRM2). (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Small Interfering RNA, Transfection, Marker, Activation Assay, Western Blot, Plasmid Preparation, Control, Expressing

(A)-(C) The correlation of gene alteration with the fraction of genome altered (FGA) and Gleason grades in TCGA cohort was visualized in (A). The statistical quantitation was shown in (B) and (C). (D) The correlation of RRM2 level with Gleason grade in tumor and matched normal tissues in the PHS/HPFS cohorts. (E) and (F) The correlation of RRM2 expression with tumor progression in Taylor and Grasso cohorts. RRM2 levels were analyzed in prostate gland (PG), primary (Pri), and metastasis (Met) tissue samples. (G) The association of RRM2 expression and the disease-free survival in the TCGA, Taylor, and Glinsky cohorts. (H) The correlation of RRM2 with the risk of lethal prostate cancer over long-term follow-up, independent from clinical characteristics and Gleason grade, in the combined HPFS and PHS prostate cancer cohorts. The odd ratios for lethal disease were adjusted for Gleason score. ****, p<0.0001 vs comparator groups.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A)-(C) The correlation of gene alteration with the fraction of genome altered (FGA) and Gleason grades in TCGA cohort was visualized in (A). The statistical quantitation was shown in (B) and (C). (D) The correlation of RRM2 level with Gleason grade in tumor and matched normal tissues in the PHS/HPFS cohorts. (E) and (F) The correlation of RRM2 expression with tumor progression in Taylor and Grasso cohorts. RRM2 levels were analyzed in prostate gland (PG), primary (Pri), and metastasis (Met) tissue samples. (G) The association of RRM2 expression and the disease-free survival in the TCGA, Taylor, and Glinsky cohorts. (H) The correlation of RRM2 with the risk of lethal prostate cancer over long-term follow-up, independent from clinical characteristics and Gleason grade, in the combined HPFS and PHS prostate cancer cohorts. The odd ratios for lethal disease were adjusted for Gleason score. ****, p<0.0001 vs comparator groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Quantitation Assay, Expressing

(A) Gene set enrichment analysis (GSEA) of transcriptomic changes. The histograms showed the distribution of select top GSEA molecular signatures: MYC targets (MYC_up_V1_up gene set); E2F targets (hallmark_E2F_targets gene set), cell cycle (Module_54 gene set), p53 pathway (hallmark_p53_pathway), and apoptosis (hallmark apoptosis). Up-gene (up-regulated genes); Down-gene (down-regulated genes). (B) Multiple targets of pathways were validated by quantitative reverse transcription PCR (qRT-PCR). (C) siRRM2-regulated gene profiling and the correlation of these genes with disease-free survival (DFS) in Taylor cohort. (D) Significant enrichment in EMT and Angiogenesis gene sets in RRM2-overexpressing PC-3 cells. (E) RRM2-regulated 126-gene profiling and correlation with the clinical outcome in clinical cohorts. 126 genes were revealed by overlapping 1230 up-regulated genes in PC3-RRM2 cells with 627 common genes positively correlated with RRM2 overexpression in three prostate cancer cohorts (TCGA, Kumar, and SU2C/PCF). The correlation of these genes with disease-free survival was analyzed in the Taylor cohort.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) Gene set enrichment analysis (GSEA) of transcriptomic changes. The histograms showed the distribution of select top GSEA molecular signatures: MYC targets (MYC_up_V1_up gene set); E2F targets (hallmark_E2F_targets gene set), cell cycle (Module_54 gene set), p53 pathway (hallmark_p53_pathway), and apoptosis (hallmark apoptosis). Up-gene (up-regulated genes); Down-gene (down-regulated genes). (B) Multiple targets of pathways were validated by quantitative reverse transcription PCR (qRT-PCR). (C) siRRM2-regulated gene profiling and the correlation of these genes with disease-free survival (DFS) in Taylor cohort. (D) Significant enrichment in EMT and Angiogenesis gene sets in RRM2-overexpressing PC-3 cells. (E) RRM2-regulated 126-gene profiling and correlation with the clinical outcome in clinical cohorts. 126 genes were revealed by overlapping 1230 up-regulated genes in PC3-RRM2 cells with 627 common genes positively correlated with RRM2 overexpression in three prostate cancer cohorts (TCGA, Kumar, and SU2C/PCF). The correlation of these genes with disease-free survival was analyzed in the Taylor cohort.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Reverse Transcription, Quantitative RT-PCR, Over Expression

(A) dNTP production in COH29-treated C4-2 cells. Two doses of COH29 were used in C4-2 cells, and dNTP production was detected after 24 hours of treatment. (B) and (C) Activation of DNA damage markers. (D) Cell proliferation assay. (E) Cell cycle analysis after 48 hours of COH29 treatment. (F) COH29-induced apoptosis. (G) The global mRNA changes induced by COH29 in C4-2 cells, after 48 hours of treatment. (H) GSEA analysis of mRNA profiling in 20 μM of COH29-treated cells. The histograms showed the distribution of select top GSEA molecular signatures. Up-gene (COH29-induced up-regulated genes); Down-gene (COH29-induced down-regulated genes). NES, normalized enrichment score; FDR, false discovery rate. (I) and (J) Identification of targeted genes by inhibition of RRM2. Genes affected by inhibition of RRM2 in cells were overlapped with genes correlated with RRM2 overexpression in Taylor cohort to reveal 33 down-regulated genes and 12 up-regulated genes (I). These gene panels were validated in three additional prostate cancer cohorts (J). The Figure 4 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) dNTP production in COH29-treated C4-2 cells. Two doses of COH29 were used in C4-2 cells, and dNTP production was detected after 24 hours of treatment. (B) and (C) Activation of DNA damage markers. (D) Cell proliferation assay. (E) Cell cycle analysis after 48 hours of COH29 treatment. (F) COH29-induced apoptosis. (G) The global mRNA changes induced by COH29 in C4-2 cells, after 48 hours of treatment. (H) GSEA analysis of mRNA profiling in 20 μM of COH29-treated cells. The histograms showed the distribution of select top GSEA molecular signatures. Up-gene (COH29-induced up-regulated genes); Down-gene (COH29-induced down-regulated genes). NES, normalized enrichment score; FDR, false discovery rate. (I) and (J) Identification of targeted genes by inhibition of RRM2. Genes affected by inhibition of RRM2 in cells were overlapped with genes correlated with RRM2 overexpression in Taylor cohort to reveal 33 down-regulated genes and 12 up-regulated genes (I). These gene panels were validated in three additional prostate cancer cohorts (J). The Figure 4 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Activation Assay, Proliferation Assay, Cell Cycle Assay, Inhibition, Over Expression, Control

(A)-(B) Phospho-kinase array analysis after 24-hour COH29 treatment in C4-2 cells. The whole-cell lysates were collected for human phospho-kinase array analysis. Each membrane contains kinase-specific antibodies (number indicated). Relative phosphorylation of spots was quantified by Image J software and the value of vehicle (0 μM) was set up as “1” (B). (C) Validation of phospho-kinase array by immunoblots. For siRNA-treated groups, cell lysates were collected after transfection for 48 hours. The representative blots for each condition are shown and the values represent the mean ± S.E. of two independent experiments. (D) Druggable RRM2 signatures. Top three drugs from ToppGene analysis and COH29 are shown (left panel). Numbers of genes down-regulated by docetaxel (in PC-3 cells) and docetaxel + ADT (in patients) are shown (right panel). (E)-(F) Antitumor effects of COH29 in vivo. Tumor volumes and weights were measured following oral administration of COH29 (200 mg/kg) in established C4-2 xenograft tumors (n=6 per group). Values are means ± S.E. ***P<0.001 versus vehicle mice. (G)-(H) Regulation of key genes by COH29 in vivo. Multiple genes regulated by COH29 were assessed in xenograft tumors by immunohistochemistry staining (G) or immunoblotting (H).

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A)-(B) Phospho-kinase array analysis after 24-hour COH29 treatment in C4-2 cells. The whole-cell lysates were collected for human phospho-kinase array analysis. Each membrane contains kinase-specific antibodies (number indicated). Relative phosphorylation of spots was quantified by Image J software and the value of vehicle (0 μM) was set up as “1” (B). (C) Validation of phospho-kinase array by immunoblots. For siRNA-treated groups, cell lysates were collected after transfection for 48 hours. The representative blots for each condition are shown and the values represent the mean ± S.E. of two independent experiments. (D) Druggable RRM2 signatures. Top three drugs from ToppGene analysis and COH29 are shown (left panel). Numbers of genes down-regulated by docetaxel (in PC-3 cells) and docetaxel + ADT (in patients) are shown (right panel). (E)-(F) Antitumor effects of COH29 in vivo. Tumor volumes and weights were measured following oral administration of COH29 (200 mg/kg) in established C4-2 xenograft tumors (n=6 per group). Values are means ± S.E. ***P<0.001 versus vehicle mice. (G)-(H) Regulation of key genes by COH29 in vivo. Multiple genes regulated by COH29 were assessed in xenograft tumors by immunohistochemistry staining (G) or immunoblotting (H).

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Membrane, Phospho-proteomics, Software, Biomarker Discovery, Western Blot, Transfection, In Vivo, Immunohistochemistry, Staining

(A) H3K27Ac ChIP-Seq in tissues. The binding signal on RRM2 enhancer (1Mb region) was quantified. (B) The strategy to identify RRM2-targeting transcription factors (TFs). Human TFs were selected in the genes positively correlated with RRM2 expression in prostate cancer cohorts. Yellow/orange/pink bars indicate that TFs appear in four/three/two cohorts. (C) The correlation of FOXM1 and RRM2 in PHS/HPFS cohorts. (D) FOXM1 binding on RRM2 promoter in cancer cells. The overview of multiple ChIP-Seq datasets were extracted from Cistrome Data browser. P1-P3 primers were designed for FOXM1 ChIP-PCR. (E) FOXM1 or H3K4me3-ChIP-PCR on RRM2 promoter. (F) RRM2 promoter activity regulated by FOXM1. The reporters without (R2-0K) or with (R2-3K) 3kb RRM2 promoter sequence were transfected in siRNA-treated 22Rv1 cells. (G) and (H) Inhibition of RRM2 expression by siFOXM1 in 22Rv1 and C4-2 cells. (I) Inhibition of FOXM1 targets by FDI-6 (20 μM) in 22Rv1 cells. The Figure 6 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) H3K27Ac ChIP-Seq in tissues. The binding signal on RRM2 enhancer (1Mb region) was quantified. (B) The strategy to identify RRM2-targeting transcription factors (TFs). Human TFs were selected in the genes positively correlated with RRM2 expression in prostate cancer cohorts. Yellow/orange/pink bars indicate that TFs appear in four/three/two cohorts. (C) The correlation of FOXM1 and RRM2 in PHS/HPFS cohorts. (D) FOXM1 binding on RRM2 promoter in cancer cells. The overview of multiple ChIP-Seq datasets were extracted from Cistrome Data browser. P1-P3 primers were designed for FOXM1 ChIP-PCR. (E) FOXM1 or H3K4me3-ChIP-PCR on RRM2 promoter. (F) RRM2 promoter activity regulated by FOXM1. The reporters without (R2-0K) or with (R2-3K) 3kb RRM2 promoter sequence were transfected in siRNA-treated 22Rv1 cells. (G) and (H) Inhibition of RRM2 expression by siFOXM1 in 22Rv1 and C4-2 cells. (I) Inhibition of FOXM1 targets by FDI-6 (20 μM) in 22Rv1 cells. The Figure 6 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: ChIP-sequencing, Binding Assay, Expressing, Activity Assay, Sequencing, Transfection, Inhibition, Control

MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Gene Expression, Expressing

Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot

Summary of correlative study results and relation to clinical outcomes

Journal: Cancer chemotherapy and pharmacology

Article Title: Phase II trial of the ribonucleotide reductase inhibitor 3-aminopyridine-2-carboxaldehydethiosemicarbazone plus gemcitabine in patients with advanced biliary tract cancer

doi: 10.1007/s00280-010-1481-z

Figure Lengend Snippet: Summary of correlative study results and relation to clinical outcomes

Article Snippet: The qPCR reactions were carried out in triplicate using cDNA and the following assays from Applied Biosciences (Foster City, CA): Hs01072069_g1 (ribonucleotide reductase M1 [RRM1]), Hs01040698_m1 (ribonucleotide reductase M2 [RRM2]), and Hs00968432_m1 (ribonucleotide reductase M2B [p53R2]).

Techniques: In Situ

a–d In situ RT–PCR analysis of RRM2 expression in fine needle tumor aspirate of tumor samples pre-treatment (a, c) and 24-h post-treatment (b, d) with gemcitabine and 3-AP in patients 4 (a, b) and 6 (c, d). Black arrows indicate nuclear staining, while gray arrows indicate cytoplasmic staining. There was qualitatively increased RRM2 mRNA expression when compared with pre-treatment samples in both patients, suggesting in vivo inhibition of ribonucleotide reductase

Journal: Cancer chemotherapy and pharmacology

Article Title: Phase II trial of the ribonucleotide reductase inhibitor 3-aminopyridine-2-carboxaldehydethiosemicarbazone plus gemcitabine in patients with advanced biliary tract cancer

doi: 10.1007/s00280-010-1481-z

Figure Lengend Snippet: a–d In situ RT–PCR analysis of RRM2 expression in fine needle tumor aspirate of tumor samples pre-treatment (a, c) and 24-h post-treatment (b, d) with gemcitabine and 3-AP in patients 4 (a, b) and 6 (c, d). Black arrows indicate nuclear staining, while gray arrows indicate cytoplasmic staining. There was qualitatively increased RRM2 mRNA expression when compared with pre-treatment samples in both patients, suggesting in vivo inhibition of ribonucleotide reductase

Article Snippet: The qPCR reactions were carried out in triplicate using cDNA and the following assays from Applied Biosciences (Foster City, CA): Hs01072069_g1 (ribonucleotide reductase M1 [RRM1]), Hs01040698_m1 (ribonucleotide reductase M2 [RRM2]), and Hs00968432_m1 (ribonucleotide reductase M2B [p53R2]).

Techniques: In Situ, Reverse Transcription Polymerase Chain Reaction, Expressing, Staining, In Vivo, Inhibition

QRT-PCR analysis of RRM1, RRM2, and RRM2b represents fold change in RRM1, RRM2, and RRM2b mRNA expression in peripheral blood mononuclear cells 24-h post-treatment with 3-AP plus gemcitabine in patients 4, 16, 27 and 31. Fold change is relative to pre-treatment sample, and all samples were normalized to TATA-binding protein (TBP). There was a quantitative decrease in PBMC RRM2 mRNA expression after 3-AP/gemcitabine therapy in 3 of 4 patients evaluated, and variable effects observed in RRM1 and RRM2b

Journal: Cancer chemotherapy and pharmacology

Article Title: Phase II trial of the ribonucleotide reductase inhibitor 3-aminopyridine-2-carboxaldehydethiosemicarbazone plus gemcitabine in patients with advanced biliary tract cancer

doi: 10.1007/s00280-010-1481-z

Figure Lengend Snippet: QRT-PCR analysis of RRM1, RRM2, and RRM2b represents fold change in RRM1, RRM2, and RRM2b mRNA expression in peripheral blood mononuclear cells 24-h post-treatment with 3-AP plus gemcitabine in patients 4, 16, 27 and 31. Fold change is relative to pre-treatment sample, and all samples were normalized to TATA-binding protein (TBP). There was a quantitative decrease in PBMC RRM2 mRNA expression after 3-AP/gemcitabine therapy in 3 of 4 patients evaluated, and variable effects observed in RRM1 and RRM2b

Article Snippet: The qPCR reactions were carried out in triplicate using cDNA and the following assays from Applied Biosciences (Foster City, CA): Hs01072069_g1 (ribonucleotide reductase M1 [RRM1]), Hs01040698_m1 (ribonucleotide reductase M2 [RRM2]), and Hs00968432_m1 (ribonucleotide reductase M2B [p53R2]).

Techniques: Quantitative RT-PCR, Expressing, Binding Assay

Expression levels of RRM2 subunit in gastric cancer cell lines. (A) Expression levels of the RRM2 subunit were examined by western blotting. Each group of samples was measured separately under the same exposure conditions. Almost all cell lines expressed RRM2; however, RRM2 expression was very low in MKN45 cells. (B) Expression levels of RRM2 were examined in MKN45 cells infected with T-hTERT. MKN45 cells were infected with PBS (−) (left), T-null (middle) or T-hTERT (right). (C) Expression levels of RRM2 in MKN45 cells were semi-quantified using a densitometer and RRM2 expression was increased almost 5-fold compared with the T-null group. *P<0.005. RRM2, ribonucleotide reductase M2; hTERT, human telomerase reverse transcriptase; T-hTERT, oncolytic HSVs which contain the ICP6 gene under the regulation of the hTERT promoter; T-null, oncolytic HSVs which contain the ICP6 gene not regulated by the hTERT promoter.

Journal: Oncology Letters

Article Title: Oncolytic virotherapy with human telomerase reverse transcriptase promoter regulation enhances cytotoxic effects against gastric cancer

doi: 10.3892/ol.2021.12751

Figure Lengend Snippet: Expression levels of RRM2 subunit in gastric cancer cell lines. (A) Expression levels of the RRM2 subunit were examined by western blotting. Each group of samples was measured separately under the same exposure conditions. Almost all cell lines expressed RRM2; however, RRM2 expression was very low in MKN45 cells. (B) Expression levels of RRM2 were examined in MKN45 cells infected with T-hTERT. MKN45 cells were infected with PBS (−) (left), T-null (middle) or T-hTERT (right). (C) Expression levels of RRM2 in MKN45 cells were semi-quantified using a densitometer and RRM2 expression was increased almost 5-fold compared with the T-null group. *P<0.005. RRM2, ribonucleotide reductase M2; hTERT, human telomerase reverse transcriptase; T-hTERT, oncolytic HSVs which contain the ICP6 gene under the regulation of the hTERT promoter; T-null, oncolytic HSVs which contain the ICP6 gene not regulated by the hTERT promoter.

Article Snippet: Anti-RRM2 antibody (sc-10846; Santa Cruz Biotechnology, Inc.) or goat polyclonal anti-β-actin antibody (sc-47778, Santa Cruz Biotechnology, Inc.) were used as primary antibodies ( ).

Techniques: Expressing, Western Blot, Infection, Reverse Transcription

Overexpression of RRM2 decreased TSP-1 expression in KB-M2-D and KB-HURs cells . (A) Western blot analysis confirmed that only RRM2 was overexpressed in KB-M2-D and KB-HURs; the expression of RRM1 and p53R2 was not significantly modulated in both KB-M2-D and KB-HURs; and the expression of TSP-1 was significantly decreased in KB-M2-D and KB-HURs cells by 60%~70% (TSP1-CM: TSP-1 in concentrated condition medium, TSP1-T: TSP-1 in total protein). (B) Representative quantitative densitometric analysis of RRM2 and TSP-1 expression. Signal intensities were normalized to that of β-actin serving as loading control; data was presented as fold of KB. (C) q-RT-PCR analysis confirmed that RRM2 mRNA was dramatically overexpressed in KB-M2D and KB-HURs compared with parental KB (** p < 0.01). Values of q-RT-PCR were the mean ± SD of three independent experiments and presented as ratio to the level of parental KB cells. (D) q-RT-PCR analysis showed TSP-1 mRNA was significantly decreased in KB-M2D and KB-HURs compared with parental KB (** p < 0.01).

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Overexpression of RRM2 decreased TSP-1 expression in KB-M2-D and KB-HURs cells . (A) Western blot analysis confirmed that only RRM2 was overexpressed in KB-M2-D and KB-HURs; the expression of RRM1 and p53R2 was not significantly modulated in both KB-M2-D and KB-HURs; and the expression of TSP-1 was significantly decreased in KB-M2-D and KB-HURs cells by 60%~70% (TSP1-CM: TSP-1 in concentrated condition medium, TSP1-T: TSP-1 in total protein). (B) Representative quantitative densitometric analysis of RRM2 and TSP-1 expression. Signal intensities were normalized to that of β-actin serving as loading control; data was presented as fold of KB. (C) q-RT-PCR analysis confirmed that RRM2 mRNA was dramatically overexpressed in KB-M2D and KB-HURs compared with parental KB (** p < 0.01). Values of q-RT-PCR were the mean ± SD of three independent experiments and presented as ratio to the level of parental KB cells. (D) q-RT-PCR analysis showed TSP-1 mRNA was significantly decreased in KB-M2D and KB-HURs compared with parental KB (** p < 0.01).

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Over Expression, Expressing, Western Blot, Control, Reverse Transcription Polymerase Chain Reaction

Overexpression of RRM2 increased VEGF expression in KB-M2-D and KB-HURs cells . (A) VEGF in condition mediums of KB-M2-D and Kb-HURs were increased by 2.4-fold and 2.1-fold respectively. Levels of VEGF in the condition medium were measured with ELISA. Data, presented as ng of VEGF protein/ml of medium and per mg of total protein, was the mean ± SD of 2–3 preparation. (B) q-RT-PCR analysis showed that VEGF mRNA was increased in KB-M2D and KB-HURs by 3~4 fold compared with parental KB and KB-V cells. (C) Compared with KB-V, KB-M2-D secreted more VEGF under both normoxia and hypoxia. (D) q-RT-PCR analysis showed KB-M2D expressed more VEGF mRNA than KB-V under both normoxia and hypoxia, * p < 0.05, ** p < 0.01 compared with KB-V.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Overexpression of RRM2 increased VEGF expression in KB-M2-D and KB-HURs cells . (A) VEGF in condition mediums of KB-M2-D and Kb-HURs were increased by 2.4-fold and 2.1-fold respectively. Levels of VEGF in the condition medium were measured with ELISA. Data, presented as ng of VEGF protein/ml of medium and per mg of total protein, was the mean ± SD of 2–3 preparation. (B) q-RT-PCR analysis showed that VEGF mRNA was increased in KB-M2D and KB-HURs by 3~4 fold compared with parental KB and KB-V cells. (C) Compared with KB-V, KB-M2-D secreted more VEGF under both normoxia and hypoxia. (D) q-RT-PCR analysis showed KB-M2D expressed more VEGF mRNA than KB-V under both normoxia and hypoxia, * p < 0.05, ** p < 0.01 compared with KB-V.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Over Expression, Expressing, Enzyme-linked Immunosorbent Assay, Reverse Transcription Polymerase Chain Reaction

Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Knockdown, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot

Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in LNCaP Cells . (A) q-RT-PCR analysis confirmed that RRM2 mRNA decreased by ~80%, and TSP-1 mRNA increased by ~8 folds in LNCaP cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~3.4-fold (Ln-Wt: LNCaP cell, Sc-siR: scramble siRNA transfected LNCaP, R2-siR: RRM2 siRNA transfected LNCaP). (C) q-RT-PCR analysis confirmed that RRM2 mRNA was significantly decreased in LNCaP at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in LNCaP cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of LNCaP was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transefected.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in LNCaP Cells . (A) q-RT-PCR analysis confirmed that RRM2 mRNA decreased by ~80%, and TSP-1 mRNA increased by ~8 folds in LNCaP cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~3.4-fold (Ln-Wt: LNCaP cell, Sc-siR: scramble siRNA transfected LNCaP, R2-siR: RRM2 siRNA transfected LNCaP). (C) q-RT-PCR analysis confirmed that RRM2 mRNA was significantly decreased in LNCaP at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in LNCaP cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of LNCaP was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transefected.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Knockdown, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot

Overexpression of RRM2 promoted the growth of KB-M2-D in vivo . (A) Typical RT-CES traces described that KB and KB-M2-D proliferated in an equal rate. CI was recorded every half hour. Each trace for each cell was an average of 4 replicates. (B) Tumor growth curves showed that RRM2 significantly promoted KB-M2-D in vivo growth. (C) Overexpression of RRM2 increased tumor xenografts size of KB-M2-D at the end of experiment. (D) q-RT-PCR analysis confirmed that RRM2, VEGF and TSP-1 mRNA was significantly different in KB-V and KB-M2 xenografts. * p < 0.05; ** p < 0.01, compared with Kb-V. Data expressed was the mean ± SD of 12 mice of two independent experiments.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Overexpression of RRM2 promoted the growth of KB-M2-D in vivo . (A) Typical RT-CES traces described that KB and KB-M2-D proliferated in an equal rate. CI was recorded every half hour. Each trace for each cell was an average of 4 replicates. (B) Tumor growth curves showed that RRM2 significantly promoted KB-M2-D in vivo growth. (C) Overexpression of RRM2 increased tumor xenografts size of KB-M2-D at the end of experiment. (D) q-RT-PCR analysis confirmed that RRM2, VEGF and TSP-1 mRNA was significantly different in KB-V and KB-M2 xenografts. * p < 0.05; ** p < 0.01, compared with Kb-V. Data expressed was the mean ± SD of 12 mice of two independent experiments.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Over Expression, In Vivo, Reverse Transcription Polymerase Chain Reaction

CD31 immunohistochemistry assay displayed that overexpression of RRM2 resulted in more vascularized tumor xenografts . Representative immunohistochemical assay of vascularization of tumor xenografts generated in vivo by (A) KB-V and (B) KB-M2-D cells (×100). (C) Semi-quantitative analysis showed that CD31 staining was significantly increased in KB-M2D tumor xenografts compared with that of KB-V, * p < 0.05. Values expressed were the mean ± SD of 8 mice of two independent experiments.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: CD31 immunohistochemistry assay displayed that overexpression of RRM2 resulted in more vascularized tumor xenografts . Representative immunohistochemical assay of vascularization of tumor xenografts generated in vivo by (A) KB-V and (B) KB-M2-D cells (×100). (C) Semi-quantitative analysis showed that CD31 staining was significantly increased in KB-M2D tumor xenografts compared with that of KB-V, * p < 0.05. Values expressed were the mean ± SD of 8 mice of two independent experiments.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Immunohistochemistry, Over Expression, Immunohistochemical staining, Generated, In Vivo, Staining

MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

The E2F8-RRM2 axis promotes DNA repair and confers drug resistance in GBC cells ( A ) Western blot analysis of E2F8 and RRM2 protein expression in parental (NOZ, GBC-SD) and gemcitabine-resistant (NOZ-R, and GBC-SD-R) cells. GAPDH was used as a loading control ( B ) Knockdown of E2F8 using two independent shRNAs (shE2F8 #1 and #2) reduces RRM2 protein levels in NOZ-R and GBC-SD-R cells compared to non-targeting control (shNC) ( C ) Ectopic expression of E2F8 increases RRM2 protein levels in NOZ and GBC-SD cells, as shown by Western blotting ( D ) Quantification of E2F8 and RRM2 IHC staining in primary and recurrent gallbladder cancer tissues. H-scores were calculated from 10 patients per group, with recurrent cases having received gemcitabine and cisplatin treatment. Scatter dot plots represent mean ± SD (unpaired t-test; ** p < 0.01) ( E ) Representative H&E (hematoxylin and eosin) and IHC staining images of E2F8 and RRM2 in tumor tissues from 10 gallbladder cancer patients. Samples from patients 1–5 (Pt1-5) represent primary tumors, whereas those from patients 6–10 (Pt6-10) represent recurrent tumors. Scale bars: H&E, 100 μm; IHC, 50 μm ( F ) Cross-platform correlation analyses reveal a consistent positive association between E2F8 and RRM2 expression across NCI60, CCLE, and GDSC cell line datasets ( G ) E2F8 and RRM2 mRNA levels are positively correlated in the TCGA cholangiocarcinoma cohort ( H ) E2F8 knockdown sensitizes NOZ-R cells to Olaparib (1 µM, 3 days), an effect that is reversed by RRM2 overexpression. E2F8 and RRM2 protein levels were confirmed by Western blotting. Apoptotic cells were quantified by Annexin V/PI staining and flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( I ) Colony formation assays show that overexpression of RRM2 rescues the impaired proliferative capacity of E2F8-knockdown NOZ-R cells ( J ) E2F8 overexpression fails to rescue the proliferation defect induced by RRM2 knockdown in NOZ-R cells (K-L) Representative images and quantification of γ-H2AX foci in NOZ-R ( K ) and GBC-SD-R ( L ) cells. Cells with stable E2F8 knockdown (shE2F8 #1 and #2) or shNC, with or without RRM2 overexpression, were treated with Olaparib (1 µM) for 4 h prior to fixation and staining. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: The E2F8-RRM2 axis promotes DNA repair and confers drug resistance in GBC cells ( A ) Western blot analysis of E2F8 and RRM2 protein expression in parental (NOZ, GBC-SD) and gemcitabine-resistant (NOZ-R, and GBC-SD-R) cells. GAPDH was used as a loading control ( B ) Knockdown of E2F8 using two independent shRNAs (shE2F8 #1 and #2) reduces RRM2 protein levels in NOZ-R and GBC-SD-R cells compared to non-targeting control (shNC) ( C ) Ectopic expression of E2F8 increases RRM2 protein levels in NOZ and GBC-SD cells, as shown by Western blotting ( D ) Quantification of E2F8 and RRM2 IHC staining in primary and recurrent gallbladder cancer tissues. H-scores were calculated from 10 patients per group, with recurrent cases having received gemcitabine and cisplatin treatment. Scatter dot plots represent mean ± SD (unpaired t-test; ** p < 0.01) ( E ) Representative H&E (hematoxylin and eosin) and IHC staining images of E2F8 and RRM2 in tumor tissues from 10 gallbladder cancer patients. Samples from patients 1–5 (Pt1-5) represent primary tumors, whereas those from patients 6–10 (Pt6-10) represent recurrent tumors. Scale bars: H&E, 100 μm; IHC, 50 μm ( F ) Cross-platform correlation analyses reveal a consistent positive association between E2F8 and RRM2 expression across NCI60, CCLE, and GDSC cell line datasets ( G ) E2F8 and RRM2 mRNA levels are positively correlated in the TCGA cholangiocarcinoma cohort ( H ) E2F8 knockdown sensitizes NOZ-R cells to Olaparib (1 µM, 3 days), an effect that is reversed by RRM2 overexpression. E2F8 and RRM2 protein levels were confirmed by Western blotting. Apoptotic cells were quantified by Annexin V/PI staining and flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( I ) Colony formation assays show that overexpression of RRM2 rescues the impaired proliferative capacity of E2F8-knockdown NOZ-R cells ( J ) E2F8 overexpression fails to rescue the proliferation defect induced by RRM2 knockdown in NOZ-R cells (K-L) Representative images and quantification of γ-H2AX foci in NOZ-R ( K ) and GBC-SD-R ( L ) cells. Cells with stable E2F8 knockdown (shE2F8 #1 and #2) or shNC, with or without RRM2 overexpression, were treated with Olaparib (1 µM) for 4 h prior to fixation and staining. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Western Blot, Expressing, Control, Knockdown, Immunohistochemistry, Over Expression, Staining, Flow Cytometry

Identification of HIT-4 as an inhibitor of E2F8-DNA interaction through high-throughput virtual screening. ( A ) Schematic illustration of the E2F8 DNA-binding pocket (purple, left), and the virtual screening workflow (right) using Schrödinger software. A compound library of over 1.62 million small molecules was subjected to high-throughput virtual screening (HTVS), followed by standard precision (SP) and extra precision (XP) docking. Compounds were further filtered based on binding free energy (< −7 kcal/mol), pan-assay interference structures (PAINS), and quantitative estimation of drug-likeness (QED), yielding 9 candidate compounds ( B ) Scatter plot of molecular weight versus docking scores for 1,264 compounds after HTVS-SP-XP screening. The top 9 hits are highlighted in red ( C ) RT-PCR analysis of RRM2 mRNA levels in NOZ/NOZ-R (left) and GBC-SD/GBC-SD-R (right) cells following treatment with each of the top 9 candidate compounds (HIT-1 to HIT-9; 10 µM for 6 h). DMSO was used as the control. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( D ) Chemical structure of HIT-4 (left) and surface plasmon resonance (SPR) analysis of its binding affinity to E2F8 (right). E2F8 was immobilized on a CM5 sensor chip, and kinetic constants were calculated using Biacore 8 K evaluation software with a 1:1 steady-state affinity model. RU, resonance units ( E ) Dose-response curve of HIT-4 binding to E2F8 measured by MicroScale Thermophoresis (MST). Experiments were conducted in triplicate using 80% excitation and 40% MST power. Binding constants were calculated using MO. Affinity Analysis software. FNorm, normalized fluorescence ( F ) Molecular docking model of HIT-4 binding to the E2F8 DNA-binding pocket (left), with a detailed interaction view (right) showing key interacting residues and molecular distances ( G ) Luciferase reporter assays in NOZ and GBC-SD cells transfected with wild-type E2F8, single-point mutants (R156A, R314A), or a double mutant (R156A/R314A), along with an RRM2 promoter-driven luciferase construct. Luminescence was measured 6 h post-transfection. Data are shown as mean ± SD from three independent experiments (two-tailed t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( H ) SPR analysis of HIT-4 binding affinity to E2F8 mutant (R156A and R314A) ( I ) Western blot analysis of RRM2 protein levels in NOZ-R and GBC-SD-R cells after treatment with increasing concentrations of HIT-4 ( J ) Schematic representation of predicted E2F8 binding sites (red) and a negative control region (blue) within the RRM2 promoter based on JASPAR prediction (top). ChIP-qPCR was performed to assess E2F8 enrichment at these sites in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM) or DMSO for 6 h. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001)

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: Identification of HIT-4 as an inhibitor of E2F8-DNA interaction through high-throughput virtual screening. ( A ) Schematic illustration of the E2F8 DNA-binding pocket (purple, left), and the virtual screening workflow (right) using Schrödinger software. A compound library of over 1.62 million small molecules was subjected to high-throughput virtual screening (HTVS), followed by standard precision (SP) and extra precision (XP) docking. Compounds were further filtered based on binding free energy (< −7 kcal/mol), pan-assay interference structures (PAINS), and quantitative estimation of drug-likeness (QED), yielding 9 candidate compounds ( B ) Scatter plot of molecular weight versus docking scores for 1,264 compounds after HTVS-SP-XP screening. The top 9 hits are highlighted in red ( C ) RT-PCR analysis of RRM2 mRNA levels in NOZ/NOZ-R (left) and GBC-SD/GBC-SD-R (right) cells following treatment with each of the top 9 candidate compounds (HIT-1 to HIT-9; 10 µM for 6 h). DMSO was used as the control. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( D ) Chemical structure of HIT-4 (left) and surface plasmon resonance (SPR) analysis of its binding affinity to E2F8 (right). E2F8 was immobilized on a CM5 sensor chip, and kinetic constants were calculated using Biacore 8 K evaluation software with a 1:1 steady-state affinity model. RU, resonance units ( E ) Dose-response curve of HIT-4 binding to E2F8 measured by MicroScale Thermophoresis (MST). Experiments were conducted in triplicate using 80% excitation and 40% MST power. Binding constants were calculated using MO. Affinity Analysis software. FNorm, normalized fluorescence ( F ) Molecular docking model of HIT-4 binding to the E2F8 DNA-binding pocket (left), with a detailed interaction view (right) showing key interacting residues and molecular distances ( G ) Luciferase reporter assays in NOZ and GBC-SD cells transfected with wild-type E2F8, single-point mutants (R156A, R314A), or a double mutant (R156A/R314A), along with an RRM2 promoter-driven luciferase construct. Luminescence was measured 6 h post-transfection. Data are shown as mean ± SD from three independent experiments (two-tailed t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( H ) SPR analysis of HIT-4 binding affinity to E2F8 mutant (R156A and R314A) ( I ) Western blot analysis of RRM2 protein levels in NOZ-R and GBC-SD-R cells after treatment with increasing concentrations of HIT-4 ( J ) Schematic representation of predicted E2F8 binding sites (red) and a negative control region (blue) within the RRM2 promoter based on JASPAR prediction (top). ChIP-qPCR was performed to assess E2F8 enrichment at these sites in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM) or DMSO for 6 h. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001)

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: High Throughput Screening Assay, Binding Assay, Software, Drug discovery, Pan Assay, Molecular Weight, Reverse Transcription Polymerase Chain Reaction, Control, SPR Assay, Microscale Thermophoresis, Fluorescence, Luciferase, Transfection, Mutagenesis, Construct, Two Tailed Test, Western Blot, Negative Control, ChIP-qPCR

HIT-4 sensitizes gemcitabine-resistant GBC to PARP inhibition through RRM2 suppression ( A ) Combination treatment with HIT-4 and Olaparib significantly reduces tumor growth in NOZ-R subcutaneous xenograft models. A total 5 × 10 5 cells were injected into the right flank of BALB/c nude mice, followed by random assignment to receive vehicle, HIT-4 (10 mg/kg), Olaparib (50 mg/kg), or the combination. Tumor volumes were measured weekly, and tumors were harvested and weighed after 42 days of treatment. Data are represented as mean ± SD (two-way ANOVA; * p < 0.05, *** p < 0.001). Scale bar: 1 cm ( B ) Representative H&E and IHC staining of xenograft tumors tissues from NOZ-R models corresponding to (A). H-Scores for E2F8 and RRM2 expression were quantified from tumors of five individual mice per group. Data are represented as mean ± SD (two-way ANOVA; *** p < 0.001). Scale bar, 100 μm ( C ) Immunofluorescence staining of γ-H2AX in NOZ-R and GBC-SD-R xenograft tumors. Cells exhibiting more than 20 γ-H2AX foci were counted, and the percentage of γ-H2AX-positive cells was quantified. Statistical analysis was performed using two-way ANOVA. Scale bar, 20 μm ( D ) Representative H&&E staining in PDOs derived from primary (PDO1-3) and recurrent (PDO4-6) tumors. Scale bar: 50 μm ( E ) Western blot analysis of E2F8 and RRM2 expression in PDOs. GAPDH served as a loading control ( F ) Dose-response curves of PDOs treated with HIT-4 for 5 days. Cell viability was assessed using the CellTiter-Glo assay, and IC 50 values were calculated with GraphPad Prism 10. Data are presented as mean ± SD from three independent experiments ( G - H ) Representative images and quantification of cell viability in primary and recurrent PDOs treated with HIT-4, Olaparib, or their combination for 5 days. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; * p < 0.05, ** p < 0.01, *** p < 0.001). Scale bar: 200 μm

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: HIT-4 sensitizes gemcitabine-resistant GBC to PARP inhibition through RRM2 suppression ( A ) Combination treatment with HIT-4 and Olaparib significantly reduces tumor growth in NOZ-R subcutaneous xenograft models. A total 5 × 10 5 cells were injected into the right flank of BALB/c nude mice, followed by random assignment to receive vehicle, HIT-4 (10 mg/kg), Olaparib (50 mg/kg), or the combination. Tumor volumes were measured weekly, and tumors were harvested and weighed after 42 days of treatment. Data are represented as mean ± SD (two-way ANOVA; * p < 0.05, *** p < 0.001). Scale bar: 1 cm ( B ) Representative H&E and IHC staining of xenograft tumors tissues from NOZ-R models corresponding to (A). H-Scores for E2F8 and RRM2 expression were quantified from tumors of five individual mice per group. Data are represented as mean ± SD (two-way ANOVA; *** p < 0.001). Scale bar, 100 μm ( C ) Immunofluorescence staining of γ-H2AX in NOZ-R and GBC-SD-R xenograft tumors. Cells exhibiting more than 20 γ-H2AX foci were counted, and the percentage of γ-H2AX-positive cells was quantified. Statistical analysis was performed using two-way ANOVA. Scale bar, 20 μm ( D ) Representative H&&E staining in PDOs derived from primary (PDO1-3) and recurrent (PDO4-6) tumors. Scale bar: 50 μm ( E ) Western blot analysis of E2F8 and RRM2 expression in PDOs. GAPDH served as a loading control ( F ) Dose-response curves of PDOs treated with HIT-4 for 5 days. Cell viability was assessed using the CellTiter-Glo assay, and IC 50 values were calculated with GraphPad Prism 10. Data are presented as mean ± SD from three independent experiments ( G - H ) Representative images and quantification of cell viability in primary and recurrent PDOs treated with HIT-4, Olaparib, or their combination for 5 days. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; * p < 0.05, ** p < 0.01, *** p < 0.001). Scale bar: 200 μm

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Inhibition, Injection, Immunohistochemistry, Expressing, Immunofluorescence, Staining, Derivative Assay, Western Blot, Control, Glo Assay

Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in KB cells . (A) q-RT-PCR analysis showed that RRM2 mRNA was decreased by ~80%, and TSP-1 mRNA was increased by ~5 folds in KB cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~2.6-fold (KB-W: KB cell, Sc-siR: scramble siRNA transfected KB, R2-siR: RRM2 siRNA transfected KB). (C) q-RT-PCR analysis confirmed RRM2 mRNA was significantly decreased in KB cells at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in KB cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of KB was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transfected.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Knockdown, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot

Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in LNCaP Cells . (A) q-RT-PCR analysis confirmed that RRM2 mRNA decreased by ~80%, and TSP-1 mRNA increased by ~8 folds in LNCaP cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~3.4-fold (Ln-Wt: LNCaP cell, Sc-siR: scramble siRNA transfected LNCaP, R2-siR: RRM2 siRNA transfected LNCaP). (C) q-RT-PCR analysis confirmed that RRM2 mRNA was significantly decreased in LNCaP at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in LNCaP cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of LNCaP was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transefected.

Journal: Molecular Cancer

Article Title: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo : implication of RRM2 in angiogenesis

doi: 10.1186/1476-4598-8-11

Figure Lengend Snippet: Knockdown of RRM2 increased TSP-1 and decreased VEGF expression in LNCaP Cells . (A) q-RT-PCR analysis confirmed that RRM2 mRNA decreased by ~80%, and TSP-1 mRNA increased by ~8 folds in LNCaP cells at 48 h post-transfection with RRM2 siRNA. (B) Western blot analysis showed that TSP-1 protein was significantly increased by ~3.4-fold (Ln-Wt: LNCaP cell, Sc-siR: scramble siRNA transfected LNCaP, R2-siR: RRM2 siRNA transfected LNCaP). (C) q-RT-PCR analysis confirmed that RRM2 mRNA was significantly decreased in LNCaP at 48 h post-transfection under both normoxia and hypoxia. (D) q-RT-PCR analysis showed VEGF mRNA in LNCaP cells was decreased after RRM2 knockdown under both normoxia and hypoxia. (E) VEGF in condition medium of LNCaP was significantly decreased after RRM2 knockdown under both normoxia and hypoxia. Data was presented as the mean ± SD of 2–3 independent experiments, * p < 0.05, ** p < 0.01, compared with scramble siRNA transefected.

Article Snippet: The human RRM2 gene specific siRNA (sc-36338) and scramble siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Techniques: Knockdown, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot

Generation of gemcitabine-resistant GBC cell lines and genome-wide CRISPR screen for therapeutic targets ( A ) Dose-response curves and IC 50 values of gemcitabine in parental (NOZ and GBC-SD) and gemcitabine-resistant (NOZ-R and GBC-SD-R) cells, assessed by CellTiter-Glo viability assays after 5 days treatment. Data are presented as mean ± SD from three independent experiments ( B ) Volcano plots of differentially expressed genes (DEGs): NOZ-R versus NOZ (left) and GBC-SD-R versus GBC-SD (right). Significantly upregulated (red) and downregulated (blue) genes are defined by log 2 fold-change > 1 or < −1 and adjusted p < 0.05 ( C ) Venn diagrams illustrating the overlap of significantly upregulated (top) and downregulated (bottom) DEGs in NOZ-R and GBC-SD-R cells ( D ) Genome-wide CRISPR-Cas9 loss-of-function screen in NOZ-R cells under Olaparib versus DMSO treatment, highlighting top candidate genes with significant depletion (negative selection, left) or enrichment (positive selection, right) based on fold-change and p -value ( E ) Normalized sgRNA counts for the top 10 candidate genes identified from the CRISPR screen, with six sgRNAs per gene ( F ) Validation of selected screen hits (E2F8, PHF12, PTCH1 and C2orf73) by CRISPR-mediated knockout in NOZ-R and GBC-SD-R cells, followed by treatment with Olaparib (1 µM) or DMSO for 5 days. Cell viability was measured using CellTiter-Glo. Data represent mean ± SD from three independent experiments. Statistical significance was determined using two-tailed Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001; ns: not significant)

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: Generation of gemcitabine-resistant GBC cell lines and genome-wide CRISPR screen for therapeutic targets ( A ) Dose-response curves and IC 50 values of gemcitabine in parental (NOZ and GBC-SD) and gemcitabine-resistant (NOZ-R and GBC-SD-R) cells, assessed by CellTiter-Glo viability assays after 5 days treatment. Data are presented as mean ± SD from three independent experiments ( B ) Volcano plots of differentially expressed genes (DEGs): NOZ-R versus NOZ (left) and GBC-SD-R versus GBC-SD (right). Significantly upregulated (red) and downregulated (blue) genes are defined by log 2 fold-change > 1 or < −1 and adjusted p < 0.05 ( C ) Venn diagrams illustrating the overlap of significantly upregulated (top) and downregulated (bottom) DEGs in NOZ-R and GBC-SD-R cells ( D ) Genome-wide CRISPR-Cas9 loss-of-function screen in NOZ-R cells under Olaparib versus DMSO treatment, highlighting top candidate genes with significant depletion (negative selection, left) or enrichment (positive selection, right) based on fold-change and p -value ( E ) Normalized sgRNA counts for the top 10 candidate genes identified from the CRISPR screen, with six sgRNAs per gene ( F ) Validation of selected screen hits (E2F8, PHF12, PTCH1 and C2orf73) by CRISPR-mediated knockout in NOZ-R and GBC-SD-R cells, followed by treatment with Olaparib (1 µM) or DMSO for 5 days. Cell viability was measured using CellTiter-Glo. Data represent mean ± SD from three independent experiments. Statistical significance was determined using two-tailed Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001; ns: not significant)

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Genome Wide, CRISPR, Biomarker Discovery, Selection, Knock-Out, Two Tailed Test

E2F8 deficiency sensitizes gemcitabine-resistant gallbladder cancer cells to PARP inhibition. ( A ) Knockdown of E2F8 enhances sensitivity to Olaparib and gemcitabine in NOZ-R cells. Cells were transduced with control sgRNA (sgNC) or two independent sgRNAs targeting E2F8 (sgE2F8 #1 and sgE2F8 #2), followed by treatment with DMSO, Olaparib (1 µM), or gemcitabine (0.1 µM). Cell viability was measured at the indicated time points using the CellTiter-Glo assay. Data are shown as mean ± SD from three independent experiments (two-tailed t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( B ) Apoptosis analysis of NOZ-R cells transduced with sgNC or sgE2F8 (#1 and #2) and treated with DMSO, Olaparib (1 µM), or gemcitabine (0.1 µM) for three days. Apoptotic cells were detected by Annexin V/PI staining followed by flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( C ) Quantification of apoptotic cells in GBC-SD-R cells transduced with sgNC or sgE2F8 (#1 and #2) and treated with DMSO, Olaparib (1 µM), or gemcitabine (0.1 µM) for three days, as determined by Annexin V/PI staining and flow cytometry ( D - E ) Apoptosis assays in NOZ-R ( D ) and GBC-SD-R ( E ) cells stably expressing control (shNC) or E2F8-targeting shRNA (shE2F8), with or without E2F8 overexpression, followed by treatment with DMSO or Olaparib (1 µM). Apoptotic cells were quantified by flow cytometry after Annexin V/PI staining. E2F8 expression levels were confirmed by western blotting ( F ) Western blot analysis of γ-H2AX levels in NOZ, NOZ-R, GBC-SD, and GBC-SD-R cells pretreated with gemcitabine (0.5 µM) for 30 min and harvested 4 h later. Quantitative of γ-H2AX levels was performed using ImageJ software and normalized to total H2AX ( G ) Immunofluorescence detection and quantification of γ-H2AX foci per nucleus in the same panel of cell lines treated as in (F). Foci were quantified using Image-Pro Plus software. Scatter dot plots represent mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: E2F8 deficiency sensitizes gemcitabine-resistant gallbladder cancer cells to PARP inhibition. ( A ) Knockdown of E2F8 enhances sensitivity to Olaparib and gemcitabine in NOZ-R cells. Cells were transduced with control sgRNA (sgNC) or two independent sgRNAs targeting E2F8 (sgE2F8 #1 and sgE2F8 #2), followed by treatment with DMSO, Olaparib (1 µM), or gemcitabine (0.1 µM). Cell viability was measured at the indicated time points using the CellTiter-Glo assay. Data are shown as mean ± SD from three independent experiments (two-tailed t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( B ) Apoptosis analysis of NOZ-R cells transduced with sgNC or sgE2F8 (#1 and #2) and treated with DMSO, Olaparib (1 µM), or gemcitabine (0.1 µM) for three days. Apoptotic cells were detected by Annexin V/PI staining followed by flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( C ) Quantification of apoptotic cells in GBC-SD-R cells transduced with sgNC or sgE2F8 (#1 and #2) and treated with DMSO, Olaparib (1 µM), or gemcitabine (0.1 µM) for three days, as determined by Annexin V/PI staining and flow cytometry ( D - E ) Apoptosis assays in NOZ-R ( D ) and GBC-SD-R ( E ) cells stably expressing control (shNC) or E2F8-targeting shRNA (shE2F8), with or without E2F8 overexpression, followed by treatment with DMSO or Olaparib (1 µM). Apoptotic cells were quantified by flow cytometry after Annexin V/PI staining. E2F8 expression levels were confirmed by western blotting ( F ) Western blot analysis of γ-H2AX levels in NOZ, NOZ-R, GBC-SD, and GBC-SD-R cells pretreated with gemcitabine (0.5 µM) for 30 min and harvested 4 h later. Quantitative of γ-H2AX levels was performed using ImageJ software and normalized to total H2AX ( G ) Immunofluorescence detection and quantification of γ-H2AX foci per nucleus in the same panel of cell lines treated as in (F). Foci were quantified using Image-Pro Plus software. Scatter dot plots represent mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Inhibition, Knockdown, Transduction, Control, Glo Assay, Two Tailed Test, Staining, Flow Cytometry, Stable Transfection, Expressing, shRNA, Over Expression, Western Blot, Software, Immunofluorescence

The E2F8-RRM2 axis promotes DNA repair and confers drug resistance in GBC cells ( A ) Western blot analysis of E2F8 and RRM2 protein expression in parental (NOZ, GBC-SD) and gemcitabine-resistant (NOZ-R, and GBC-SD-R) cells. GAPDH was used as a loading control ( B ) Knockdown of E2F8 using two independent shRNAs (shE2F8 #1 and #2) reduces RRM2 protein levels in NOZ-R and GBC-SD-R cells compared to non-targeting control (shNC) ( C ) Ectopic expression of E2F8 increases RRM2 protein levels in NOZ and GBC-SD cells, as shown by Western blotting ( D ) Quantification of E2F8 and RRM2 IHC staining in primary and recurrent gallbladder cancer tissues. H-scores were calculated from 10 patients per group, with recurrent cases having received gemcitabine and cisplatin treatment. Scatter dot plots represent mean ± SD (unpaired t-test; ** p < 0.01) ( E ) Representative H&E (hematoxylin and eosin) and IHC staining images of E2F8 and RRM2 in tumor tissues from 10 gallbladder cancer patients. Samples from patients 1–5 (Pt1-5) represent primary tumors, whereas those from patients 6–10 (Pt6-10) represent recurrent tumors. Scale bars: H&E, 100 μm; IHC, 50 μm ( F ) Cross-platform correlation analyses reveal a consistent positive association between E2F8 and RRM2 expression across NCI60, CCLE, and GDSC cell line datasets ( G ) E2F8 and RRM2 mRNA levels are positively correlated in the TCGA cholangiocarcinoma cohort ( H ) E2F8 knockdown sensitizes NOZ-R cells to Olaparib (1 µM, 3 days), an effect that is reversed by RRM2 overexpression. E2F8 and RRM2 protein levels were confirmed by Western blotting. Apoptotic cells were quantified by Annexin V/PI staining and flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( I ) Colony formation assays show that overexpression of RRM2 rescues the impaired proliferative capacity of E2F8-knockdown NOZ-R cells ( J ) E2F8 overexpression fails to rescue the proliferation defect induced by RRM2 knockdown in NOZ-R cells (K-L) Representative images and quantification of γ-H2AX foci in NOZ-R ( K ) and GBC-SD-R ( L ) cells. Cells with stable E2F8 knockdown (shE2F8 #1 and #2) or shNC, with or without RRM2 overexpression, were treated with Olaparib (1 µM) for 4 h prior to fixation and staining. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: The E2F8-RRM2 axis promotes DNA repair and confers drug resistance in GBC cells ( A ) Western blot analysis of E2F8 and RRM2 protein expression in parental (NOZ, GBC-SD) and gemcitabine-resistant (NOZ-R, and GBC-SD-R) cells. GAPDH was used as a loading control ( B ) Knockdown of E2F8 using two independent shRNAs (shE2F8 #1 and #2) reduces RRM2 protein levels in NOZ-R and GBC-SD-R cells compared to non-targeting control (shNC) ( C ) Ectopic expression of E2F8 increases RRM2 protein levels in NOZ and GBC-SD cells, as shown by Western blotting ( D ) Quantification of E2F8 and RRM2 IHC staining in primary and recurrent gallbladder cancer tissues. H-scores were calculated from 10 patients per group, with recurrent cases having received gemcitabine and cisplatin treatment. Scatter dot plots represent mean ± SD (unpaired t-test; ** p < 0.01) ( E ) Representative H&E (hematoxylin and eosin) and IHC staining images of E2F8 and RRM2 in tumor tissues from 10 gallbladder cancer patients. Samples from patients 1–5 (Pt1-5) represent primary tumors, whereas those from patients 6–10 (Pt6-10) represent recurrent tumors. Scale bars: H&E, 100 μm; IHC, 50 μm ( F ) Cross-platform correlation analyses reveal a consistent positive association between E2F8 and RRM2 expression across NCI60, CCLE, and GDSC cell line datasets ( G ) E2F8 and RRM2 mRNA levels are positively correlated in the TCGA cholangiocarcinoma cohort ( H ) E2F8 knockdown sensitizes NOZ-R cells to Olaparib (1 µM, 3 days), an effect that is reversed by RRM2 overexpression. E2F8 and RRM2 protein levels were confirmed by Western blotting. Apoptotic cells were quantified by Annexin V/PI staining and flow cytometry. Data are presented as mean ± SD from three independent experiments (t-test; *** p < 0.001) ( I ) Colony formation assays show that overexpression of RRM2 rescues the impaired proliferative capacity of E2F8-knockdown NOZ-R cells ( J ) E2F8 overexpression fails to rescue the proliferation defect induced by RRM2 knockdown in NOZ-R cells (K-L) Representative images and quantification of γ-H2AX foci in NOZ-R ( K ) and GBC-SD-R ( L ) cells. Cells with stable E2F8 knockdown (shE2F8 #1 and #2) or shNC, with or without RRM2 overexpression, were treated with Olaparib (1 µM) for 4 h prior to fixation and staining. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001)

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Western Blot, Expressing, Control, Knockdown, Immunohistochemistry, Over Expression, Staining, Flow Cytometry

Identification of HIT-4 as an inhibitor of E2F8-DNA interaction through high-throughput virtual screening. ( A ) Schematic illustration of the E2F8 DNA-binding pocket (purple, left), and the virtual screening workflow (right) using Schrödinger software. A compound library of over 1.62 million small molecules was subjected to high-throughput virtual screening (HTVS), followed by standard precision (SP) and extra precision (XP) docking. Compounds were further filtered based on binding free energy (< −7 kcal/mol), pan-assay interference structures (PAINS), and quantitative estimation of drug-likeness (QED), yielding 9 candidate compounds ( B ) Scatter plot of molecular weight versus docking scores for 1,264 compounds after HTVS-SP-XP screening. The top 9 hits are highlighted in red ( C ) RT-PCR analysis of RRM2 mRNA levels in NOZ/NOZ-R (left) and GBC-SD/GBC-SD-R (right) cells following treatment with each of the top 9 candidate compounds (HIT-1 to HIT-9; 10 µM for 6 h). DMSO was used as the control. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( D ) Chemical structure of HIT-4 (left) and surface plasmon resonance (SPR) analysis of its binding affinity to E2F8 (right). E2F8 was immobilized on a CM5 sensor chip, and kinetic constants were calculated using Biacore 8 K evaluation software with a 1:1 steady-state affinity model. RU, resonance units ( E ) Dose-response curve of HIT-4 binding to E2F8 measured by MicroScale Thermophoresis (MST). Experiments were conducted in triplicate using 80% excitation and 40% MST power. Binding constants were calculated using MO. Affinity Analysis software. FNorm, normalized fluorescence ( F ) Molecular docking model of HIT-4 binding to the E2F8 DNA-binding pocket (left), with a detailed interaction view (right) showing key interacting residues and molecular distances ( G ) Luciferase reporter assays in NOZ and GBC-SD cells transfected with wild-type E2F8, single-point mutants (R156A, R314A), or a double mutant (R156A/R314A), along with an RRM2 promoter-driven luciferase construct. Luminescence was measured 6 h post-transfection. Data are shown as mean ± SD from three independent experiments (two-tailed t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( H ) SPR analysis of HIT-4 binding affinity to E2F8 mutant (R156A and R314A) ( I ) Western blot analysis of RRM2 protein levels in NOZ-R and GBC-SD-R cells after treatment with increasing concentrations of HIT-4 ( J ) Schematic representation of predicted E2F8 binding sites (red) and a negative control region (blue) within the RRM2 promoter based on JASPAR prediction (top). ChIP-qPCR was performed to assess E2F8 enrichment at these sites in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM) or DMSO for 6 h. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001)

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: Identification of HIT-4 as an inhibitor of E2F8-DNA interaction through high-throughput virtual screening. ( A ) Schematic illustration of the E2F8 DNA-binding pocket (purple, left), and the virtual screening workflow (right) using Schrödinger software. A compound library of over 1.62 million small molecules was subjected to high-throughput virtual screening (HTVS), followed by standard precision (SP) and extra precision (XP) docking. Compounds were further filtered based on binding free energy (< −7 kcal/mol), pan-assay interference structures (PAINS), and quantitative estimation of drug-likeness (QED), yielding 9 candidate compounds ( B ) Scatter plot of molecular weight versus docking scores for 1,264 compounds after HTVS-SP-XP screening. The top 9 hits are highlighted in red ( C ) RT-PCR analysis of RRM2 mRNA levels in NOZ/NOZ-R (left) and GBC-SD/GBC-SD-R (right) cells following treatment with each of the top 9 candidate compounds (HIT-1 to HIT-9; 10 µM for 6 h). DMSO was used as the control. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( D ) Chemical structure of HIT-4 (left) and surface plasmon resonance (SPR) analysis of its binding affinity to E2F8 (right). E2F8 was immobilized on a CM5 sensor chip, and kinetic constants were calculated using Biacore 8 K evaluation software with a 1:1 steady-state affinity model. RU, resonance units ( E ) Dose-response curve of HIT-4 binding to E2F8 measured by MicroScale Thermophoresis (MST). Experiments were conducted in triplicate using 80% excitation and 40% MST power. Binding constants were calculated using MO. Affinity Analysis software. FNorm, normalized fluorescence ( F ) Molecular docking model of HIT-4 binding to the E2F8 DNA-binding pocket (left), with a detailed interaction view (right) showing key interacting residues and molecular distances ( G ) Luciferase reporter assays in NOZ and GBC-SD cells transfected with wild-type E2F8, single-point mutants (R156A, R314A), or a double mutant (R156A/R314A), along with an RRM2 promoter-driven luciferase construct. Luminescence was measured 6 h post-transfection. Data are shown as mean ± SD from three independent experiments (two-tailed t-test; * p < 0.05, ** p < 0.01, *** p < 0.001) ( H ) SPR analysis of HIT-4 binding affinity to E2F8 mutant (R156A and R314A) ( I ) Western blot analysis of RRM2 protein levels in NOZ-R and GBC-SD-R cells after treatment with increasing concentrations of HIT-4 ( J ) Schematic representation of predicted E2F8 binding sites (red) and a negative control region (blue) within the RRM2 promoter based on JASPAR prediction (top). ChIP-qPCR was performed to assess E2F8 enrichment at these sites in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM) or DMSO for 6 h. Data are presented as mean ± SD from three independent experiments (t-test; * p < 0.05, ** p < 0.01, *** p < 0.001)

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: High Throughput Screening Assay, Binding Assay, Software, Drug discovery, Pan Assay, Molecular Weight, Reverse Transcription Polymerase Chain Reaction, Control, SPR Assay, Microscale Thermophoresis, Fluorescence, Luciferase, Transfection, Mutagenesis, Construct, Two Tailed Test, Western Blot, Negative Control, ChIP-qPCR

HIT-4 sensitizes E2F8-overexpressing, drug-resistant tumor cells to PARP inhibition. ( A ) Dose-response curves of E2F8-overexpressing NOZ-R and GBC-SD-R cells compared to their parental NOZ and GBC-SD cells following HIT-4 treatment for 5 days. Cells viability was assessed using the CellTiter-Glo assay, and IC 50 values were calculated using GraphPad Prism 10. Data are presented as mean ± SD from three independent experiments ( B ) Dose-response curves of NOZ-R and GBC-SD-R cells treated with Olaparib in the presence of either DMSO or HIT-4 (1 µM). Cell viability was measured by CellTiter-Glo assay ( C ) Quantification of apoptotic cells in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM), Olaparib (1 µM), or the combination for 3 days, followed by Annexin V/PI staining and flow cytometry. Data are shown as mean ± SD ( n = 3 independent experiments; two-way ANOVA; *** p < 0.001) ( D ) Bliss synergy maps illustrating the combinatorial effect of HIT-4 and Olaparib in shNC or shE2F8 (#1 and #2) NOZ-R and GBC-SD-R cells. Cells were treated for 96 h in biological triplicates. Bliss synergy scores greater than 10 indicate strong synergy ( E ) Representative immunofluorescence images and quantification of γ-H2AX foci in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM), Olaparib (1 µM), or the combination for 4 h. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001). Scale bar: 10 μm

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: HIT-4 sensitizes E2F8-overexpressing, drug-resistant tumor cells to PARP inhibition. ( A ) Dose-response curves of E2F8-overexpressing NOZ-R and GBC-SD-R cells compared to their parental NOZ and GBC-SD cells following HIT-4 treatment for 5 days. Cells viability was assessed using the CellTiter-Glo assay, and IC 50 values were calculated using GraphPad Prism 10. Data are presented as mean ± SD from three independent experiments ( B ) Dose-response curves of NOZ-R and GBC-SD-R cells treated with Olaparib in the presence of either DMSO or HIT-4 (1 µM). Cell viability was measured by CellTiter-Glo assay ( C ) Quantification of apoptotic cells in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM), Olaparib (1 µM), or the combination for 3 days, followed by Annexin V/PI staining and flow cytometry. Data are shown as mean ± SD ( n = 3 independent experiments; two-way ANOVA; *** p < 0.001) ( D ) Bliss synergy maps illustrating the combinatorial effect of HIT-4 and Olaparib in shNC or shE2F8 (#1 and #2) NOZ-R and GBC-SD-R cells. Cells were treated for 96 h in biological triplicates. Bliss synergy scores greater than 10 indicate strong synergy ( E ) Representative immunofluorescence images and quantification of γ-H2AX foci in NOZ-R and GBC-SD-R cells treated with HIT-4 (1 µM), Olaparib (1 µM), or the combination for 4 h. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; *** p < 0.001). Scale bar: 10 μm

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Inhibition, Glo Assay, Staining, Flow Cytometry, Immunofluorescence

HIT-4 sensitizes gemcitabine-resistant GBC to PARP inhibition through RRM2 suppression ( A ) Combination treatment with HIT-4 and Olaparib significantly reduces tumor growth in NOZ-R subcutaneous xenograft models. A total 5 × 10 5 cells were injected into the right flank of BALB/c nude mice, followed by random assignment to receive vehicle, HIT-4 (10 mg/kg), Olaparib (50 mg/kg), or the combination. Tumor volumes were measured weekly, and tumors were harvested and weighed after 42 days of treatment. Data are represented as mean ± SD (two-way ANOVA; * p < 0.05, *** p < 0.001). Scale bar: 1 cm ( B ) Representative H&E and IHC staining of xenograft tumors tissues from NOZ-R models corresponding to (A). H-Scores for E2F8 and RRM2 expression were quantified from tumors of five individual mice per group. Data are represented as mean ± SD (two-way ANOVA; *** p < 0.001). Scale bar, 100 μm ( C ) Immunofluorescence staining of γ-H2AX in NOZ-R and GBC-SD-R xenograft tumors. Cells exhibiting more than 20 γ-H2AX foci were counted, and the percentage of γ-H2AX-positive cells was quantified. Statistical analysis was performed using two-way ANOVA. Scale bar, 20 μm ( D ) Representative H&&E staining in PDOs derived from primary (PDO1-3) and recurrent (PDO4-6) tumors. Scale bar: 50 μm ( E ) Western blot analysis of E2F8 and RRM2 expression in PDOs. GAPDH served as a loading control ( F ) Dose-response curves of PDOs treated with HIT-4 for 5 days. Cell viability was assessed using the CellTiter-Glo assay, and IC 50 values were calculated with GraphPad Prism 10. Data are presented as mean ± SD from three independent experiments ( G - H ) Representative images and quantification of cell viability in primary and recurrent PDOs treated with HIT-4, Olaparib, or their combination for 5 days. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; * p < 0.05, ** p < 0.01, *** p < 0.001). Scale bar: 200 μm

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: Targeting E2F8 sensitizes gemcitabine-resistant gallbladder cancer to PARP inhibitors by disrupting RRM2-driven DNA repair

doi: 10.1186/s13046-025-03586-2

Figure Lengend Snippet: HIT-4 sensitizes gemcitabine-resistant GBC to PARP inhibition through RRM2 suppression ( A ) Combination treatment with HIT-4 and Olaparib significantly reduces tumor growth in NOZ-R subcutaneous xenograft models. A total 5 × 10 5 cells were injected into the right flank of BALB/c nude mice, followed by random assignment to receive vehicle, HIT-4 (10 mg/kg), Olaparib (50 mg/kg), or the combination. Tumor volumes were measured weekly, and tumors were harvested and weighed after 42 days of treatment. Data are represented as mean ± SD (two-way ANOVA; * p < 0.05, *** p < 0.001). Scale bar: 1 cm ( B ) Representative H&E and IHC staining of xenograft tumors tissues from NOZ-R models corresponding to (A). H-Scores for E2F8 and RRM2 expression were quantified from tumors of five individual mice per group. Data are represented as mean ± SD (two-way ANOVA; *** p < 0.001). Scale bar, 100 μm ( C ) Immunofluorescence staining of γ-H2AX in NOZ-R and GBC-SD-R xenograft tumors. Cells exhibiting more than 20 γ-H2AX foci were counted, and the percentage of γ-H2AX-positive cells was quantified. Statistical analysis was performed using two-way ANOVA. Scale bar, 20 μm ( D ) Representative H&&E staining in PDOs derived from primary (PDO1-3) and recurrent (PDO4-6) tumors. Scale bar: 50 μm ( E ) Western blot analysis of E2F8 and RRM2 expression in PDOs. GAPDH served as a loading control ( F ) Dose-response curves of PDOs treated with HIT-4 for 5 days. Cell viability was assessed using the CellTiter-Glo assay, and IC 50 values were calculated with GraphPad Prism 10. Data are presented as mean ± SD from three independent experiments ( G - H ) Representative images and quantification of cell viability in primary and recurrent PDOs treated with HIT-4, Olaparib, or their combination for 5 days. Data are shown as mean ± SD ( n = 3 independent experiments, unpaired t-test; * p < 0.05, ** p < 0.01, *** p < 0.001). Scale bar: 200 μm

Article Snippet: Rabbit monoclonal antibodies against E2F8 (#346661), RRM2 (#65939), and GAPDH (#2118) were purchased from Cell Signaling Technology.

Techniques: Inhibition, Injection, Immunohistochemistry, Expressing, Immunofluorescence, Staining, Derivative Assay, Western Blot, Control, Glo Assay